Review



50459 aav8 chemicals  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 96

    Structured Review

    Addgene inc 50459 aav8 chemicals
    50459 Aav8 Chemicals, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 593 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/aav8+chemicals/pAAV-hSyn-DIO-mCherry+(Plasmid+%2350459)/pm41330374-599-80-78
    Average 96 stars, based on 593 article reviews
    50459 aav8 chemicals - by Bioz Stars, 2026-09
    96/100 stars

    Images

    Related Articles

    Virus:

    Article Title: Cells and circuits for amygdala neuroplasticity in the transition to chronic pain.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rat anti-mCherry Invitrogen Cat# M11217; RRID: AB_2536611 Rabbit anti-b-gal Millipore Sigma Cat# ab986; RRID: AB_92401 Rat anti-somatostatin Millipore Sigma Cat# MAB354; RRID: AB_2255365 Mouse anti-PKCd BD Biosciences Cat# 610398; RRID: AB_397781 Rabbit anti-human/rat CRF Joan Vaughan, Paul Sawchenko Cat# PBL rC68; RRID: AB_2650435 Goat anti-rat Cy3 Invitrogen Cat# A10522; RRID: AB_2534031 Alexa Fluor 647-conjugated goat anti-rabbit Invitrogen Cat# A-21244; RRID: AB_2535812 Alexa Fluor 647-conjugated goat anti-rat Invitrogen Cat# A-21247; RRID: AB_141778 Alexa Fluor Plus 405-conjugated goat anti-mouse Invitrogen Cat# A48255; RRID: AB_2890536 Bacterial and virus strains AAV5-Ef1a-DIO-mCherry University of North Carolina Vector Core Lot# AV4311D, AV4311E, AV4311F, AV4311G AAV5-CaMKII-hChR2(H134R)-EYFP-WPRE-PA University of North Carolina Vector Core Lot# AV4316P, AV4316Q AAVrg-hSyn-DIO-EGFP Bryan Roth Addgene viral prep # 50457-AAVrg AAVrg-FLEX-tdTomato Edward Boyden Addgene viral prep # 28306-AAVrg AAVrg-hSyn-HI-eGFP-Cre-WPRE-SV40 James M. Wilson Addgene viral prep # 105540-AAVrg AAV8-CMV-LacZ-bGH James M. Wilson Addgene viral prep # 105531-AAV8 AAV8-hSyn-DIO-hM4D(Gi)-mCherry Krashes et al.129 Addgene viral prep # 44362-AAV8 AAV8-hSyn-DIO-mCherry Bryan Roth Addgene viral prep # 50459-AAV8 Chemicals, peptides, and recombinant proteins DL-AP5 Tocris Cat# 0105; CAS# 76326-31-3 CNQX disodium salt Tocris Cat# 1045; CAS# 479347-85-8 BIBN4096BS Millipore Sigma Cat# SML2426; CAS# 204697-65-4 Clozapine N-oxide Enzo Life Sciences Cat# BML-NS105; CAS# 34233-69-7 Streptavidin, Alexa Fluor 405 conjugate Invitrogen Cat# S32351 Experimental models: Organisms/strains Rat: Crh-Cre Robert Messing (Pomrenze et al.38) N/A Mouse: C57BL/6J Jackson Laboratory RRID:IMSR_JAX:000664 Mouse: Prkcd-Cre GENSAT RRID:MMRRC_011559-UCD Mouse: Calcrl-Cre Richard Palmiter (Han et al.47) N/A Mouse: Sst-Cre Jackson Laboratory RRID:IMSR_JAX:018973 Mouse: Ai9 Jackson Laboratory RRID:IMSR_JAX:007909 Oligonucleotides Forward primer to genotype for the presence of Cre-recombinase in rats: GCATTACCGG TCGATGCAACGAGTGATGAG Integrated DNA Technologies (IDT) www.idtdna.com Reverse primer to genotype for the presence of Cre-recombinase in rats: GAGTGAACGAA CCTGGTCGAAATCAGTGCG Integrated DNA Technologies (IDT) www.idtdna.com Forward primer to genotype for the presence of Cre-recombinase in mice: TTAATCCATAT TGGCAGAACGAAAACG Transnetyx https://www.transnetyx.com/ (Continued on next page) Cell Reports 43, 114669, September 24, 2024 21 .. REAGENT or RESOURCE SOURCE IDENTIFIER Reverse primer to genotype for the presence of Cre-recombinase in mice: CAGGCTAAGT GCCTTCTCTACA Transnetyx https://www.transnetyx.com/ Software and algorithms ImageJ Schneider et al.130 RRID:SCR_003070; https://imagej.net/ Fiji Schindelin et al.131 RRID:SCR_002285; https://fiji.sc/ pCLAMP 8.2/pCLAMP 11.2/Clampfit 11.2 Molecular Devices, Axon Instruments RRID:SCR_011323; https://www.moleculardevices. com/products/axon-patch-clamp-system/acquisitionand-analysis-software/pclamp-software-suite GraphPad Prism (version 9.5.1 or 10.0.2) GraphPad Software RRID:SCR_002798; https://www.graphpad.com/ Anaconda Distribution version 2023.

    Article Title: Integrating reproductive states and social cues in the control of sociosexual behaviors.
    Article Snippet: Article Integrating reproductive states and social cues in the control of sociosexual behaviors

    Article Title: Adeno-associated viruses for efficient gene expression in the axolotl nervous system
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit anti-RFP Rockland Cat# 600-401-379; RRID: AB_2333092 Rabbit anti-GFP Rockland Cat# 600-401-215; RRID:AB_828167 Mouse anti-GFP Thermo Fisher Scientific Cat# A-11120, RRID:AB_221568 Mouse anti-GFAP-Cy3 Conjugated, Clone G-A-5 Sigma-Aldrich Cat# C9205; RRID: AB_476889 Rabbit anti-Iba1 FUJIFILM Wako Shibayagi Cat# 019-19741, RRID:AB_839504 Goat anti-ChAT Millipore Cat# AB144P, RRID:AB_2079751 Mouse anti-Pax6 Homemade published in62 Donkey anti-mouse Alexa 488 Thermo Fisher Scientific Cat# A-21202; RRID: AB_141607 Donkey anti-mouse Alexa 568 Thermo Fisher Scientific Cat# A-10037; RRID: AB_2534013 Donkey anti-rabbit Alexa 568 Thermo Fisher Scientific Cat# A-10042; RRID: AB_2534017 Donkey anti-mouse Alexa 647 Thermo Fisher Scientific Cat# A-5 31571; RRID: AB_162542 Donkey anti-rabbit Alexa 647 Thermo Fisher Scientific Cat# A-31573; RRID: AB_2536183 Bacterial and virus strains AAV1-CAG:GFP Addgene Cat# 37825-AAV1 AAV2-CAG:GFP Addgene Cat# 37825-AAV2 AAV5-CAG:GFP Addgene Cat# 37825-AAV5 AAV8-CAG:GFP Addgene Cat# 37825-AAV8 AAV9-CAG:GFP Addgene Cat# 37825-AAV9 AAVRG-CAG:GFP Addgene Cat# 37825-AAVrg AAVPHP.eB-CAG:GFP Addgene Cat# 37825-AAVPHP.eB AAV9-CAG:tdTomato Addgene Cat# 59462-AAV9 AAVRG-CAG:tdTomato Addgene Cat# 59462-AAVrg AAV8-hSyn:GFP Addgene Cat# 50465-AAV8 AAV8-CamKIIa:GFP Addgene Cat# 50469-AAV8 Chemicals, peptides, and recombinant proteins .. DAPI Sigma-Aldrich Cat# D9542 DMSO Sigma-Aldrich Cat# D2650 Benzocaine Sigma-Aldrich Cat# E150 H2O2 Sigma-Aldrich Cat# H1009 KOH Sigma-Aldrich Cat# 105033 N,N,N’,N’-tetrakis Sigma-Aldrich Cat# 122262 Triton X-100 Sigma-Aldrich Cat# X100 N-butyldiethanolamine Sigma-Aldrich Cat# 471240 Urea Sigma-Aldrich Cat# U5128 Antipyrine Sigma-Aldrich Cat# A5882 Nicotinamide Sigma-Aldrich Cat# N3376 FastGreen FCF Merck Cat# F7258 OCT compound Science Services Cat# 62550-12 Critical commercial assays HCR Hybridization Buffer Molecular Instruments N/A HCR Amplification Buffer Molecular Instruments N/A HCR Amplifiers Molecular Instruments N/A Experimental models: Organisms/strains Ambystoma mexicanum: d/d IMP N/A Oligonucleotides oligo pool HCR probe for Gad2 IDT published in3 oligo pool HCR probe for Slc17a7 IDT published in3 oligo pool HCR probe for AAV IDT Probe sequence in Table S2.

    Article Title: GABA co-released from striatal dopamine axons dampens phasic dopamine release through autoregulatory GABA A receptors.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Biotinylated donkey anti-rabbit Jackson ImmunoResearch Labs Cat No: 711-065-152; RRID: AB_2340593 Biotinylated goat anti-mouse Vector Laboratories Cat No: BA-9200; RRID: AB_2336171 Chicken anti-Green Fluorescent Protein Aves Labs, Inc Cat No: GFP-1020; RRID: AB_10000240 Donkey anti-mouse IgG conjugated to ultrasmall (0.8 nm) colloidal gold Electron Microscopy Sciences Cat No: 25810 Donkey anti-rabbit IgG conjugated to ultrasmall (0.8 nm) colloidal gold Electron Microscopy Sciences Cat No: 25701 Donkey anti-chicken Cy3 Jackson ImmunoResearch Labs Cat No: 703-165-155; RRID: AB_2340363 Donkey anti-rabbit Cy3 Jackson ImmunoResearch Labs Cat No: 711-165-152; RRID: AB_2307443 Donkey anti-rabbit Cy2 Jackson ImmunoResearch Labs Cat No: 711-225-152; RRID: AB_2340612 Donkey anti-sheep Cy5 Jackson ImmunoResearch Labs Cat No: 713-175-147; RRID: AB_2340730 Mouse anti-Tyrosine hydroxylase monoclonal Boehringer Mannheim Cat No: 1017-381 Rabbit anti-GABAAR a3 (extracellular) polyclonal Alomone Labs Cat No: AGA-003; RRID: AB_2039866 Rabbit anti-GABAAR a3 blocking peptide Alomone Labs Cat No: BLP-GA-003 Rabbit ant-GABAAR d (extracellular) Dr. W. Sieghart N/A Rabbit anti-Tyrosine hydroxylase polyclonal Millipore Cat No: AB152; RRID: AB_390204 Sheep anti-Tyrosine hydroxylase polyclonal Abcam Cat No: ab113; RRID: AB_297905 Bacterial and virus strains AAV8-EF1a-double floxed-hChR2(H134R)mCherry-WPRE-HGHpA pAAV-EF-1a-double floxedhChR2(H134R)-mCherry-WPRE-HGHpA was a gift from Karl Deisseroth Addgene viral prep Cat No: 20297-AAV8 Chemicals, peptides, and recombinant proteins D-AP5 Hello Bio Cat No: HB0225 (+)Bicuculline Sigma-Aldrich Cat No: 14340 Calcium chloride dihydrate (CaCl2.2H2O) Sigma-Aldrich Cat No: C5080 DAB (3,30-Diaminobenzidine tetrahydrochloride) Sigma-Aldrich Cat No: D5905 DHbE hydrobromide Tocris Bioscience Cat No: 2349 DMSO (dimethyl sulfoxide) Sigma-Aldrich Cat No: 276855 DNQX Hello Bio Cat No: HB0261 DOPAC (3,4-Dihydroxyphenylacetic acid) Sigma-Aldrich Cat No: D-9128 Dopamine hydrochloride (3- hydroxytryramine) Sigma-Aldrich Cat No: H-8502 EDTA (Ethylenediaminetetraacetic acid disodium salt dihydrate) Sigma-Aldrich Cat No: E1644 Ethanol, 200 proof Fisher Scientific Cat No: A962P-4 Euthasol Covetrus SKU No: 009444 Gabazine (SR 95531) Hello Bio Cat No: HB0901 D-(+)-Glucose Sigma-Aldrich Cat No: G-5767 HEPES (Acid) Sigma-Aldrich Cat No: H-3375 HEPES (Sodium Salt) Sigma-Aldrich Cat No: H-7006 Isoflurane Covetrus (NYULH-DCM) SKU No: 029405 (Continued on next page) 16 Cell Reports 43, 113834, March 26, 2024 .. REAGENT or RESOURCE SOURCE IDENTIFIER JNJ-16259685 Tocris Bioscience Cat No: 2333 3-mercaptopropionic acid (3-MPA) Sigma-Aldrich Cat No: M5801 Magnesium sulfate heptahydrate (MgSO4.7H2O) Sigma-Aldrich Cat No: M-1880 Methanol Sigma-Aldrich Cat No: 34860 Muscimol Tocris Bioscience Cat No: 0289 Muscimol Hello Bio Cat No: HB0887 Normal Donkey Serum (NDS) Sigma-Aldrich Cat No: S30-M Paraformaldehyde Fisher Cat No: T353 Paraformaldehyde for EM (4% in 0.1M Phosphate Buffer, PH 7.4 Electron Microscopy Sciences Cat No: 15735-20S Phosphate Buffered Saline (PBS) Sigma-Aldrich Cat No: P7059 Picrotoxin Sigma-Aldrich Cat No: P1675 Picrotoxin Hello Bio Cat No: HB0506 Potassium chloride (KCl) Sigma-Aldrich Cat No: P-3911 Potassium phosphate monobasic (KH2PO4) Sigma-Aldrich Cat No: P-0662 Sodium bicarbonate (NaHC03) Sigma-Aldrich Cat No: S-6014 Sodium-1-heptanesulfanate (C7H15O3SNa) Sigma-Aldrich Cat No: H2766 Sodium chloride (NaCl) Sigma-Aldrich Cat No: S-7653 Sodium octyl sulfate Sigma-Aldrich Cat No: O-4003 Sodium phosphate monobasic monohydrate (NaH2PO4.H2O) Sigma-Aldrich Cat No: S9638 Sucrose Sigma-Aldrich Cat No: S-7903 Strychnine hydrochloride Sigma-Aldrich Cat No: S8759 Triton X-100 Sigma-Aldrich Cat No: T8787 Critical commercial assays Silver Enhancer Kit for Microscopy Kirkegaard & Perry Laboratories (KPL), Inc Cat No: 50-22-01 Vectastain Elite ABC-HRP Kit Vector Labs Cat No: PK6100 Experimental models: Organisms/strains Mouse: Ai32 Jackson Laboratory Stock No: 024109 Mouse: C57BL/6J Jackson Laboratory Stock No: 000664 Mouse: DAT-IRES-Cre Jackson Laboratory Stock No: 006660 Mouse: GAT1flox/flox Tritsch Lab, NYULH geneOway JAX stock No: 037219 Software and algorithms DropViz RNA-Seq Data Saunders et al.48 https://DropViz.org Fiji ImageJ NIH https://imagej.nih.gov/ij/ Fusion Benchtop Image Acquisition Software (ver.

    Article Title: Complementary gene regulation by NRF1 and NRF2 protects against hepatic cholesterol overload.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies anti-4HNE Abcam Cat# ab46545; RRID: AB_722490 anti-F4/80 Cell signaling technologies Cat# 70076; RRID: AB_2799771 anti-GAPDH Invitrogen Cat# AM4300; RRID: AB_2536381 anti-LAMIN A/C Cell Signaling Technology Cat# #4777; RRID: AB_10545756 anti-mouse HRP conjugate Cell signaling technologies Cat# 7076S; RRID: AB_330924 anti-NRF1 Cell Signaling Technology Cat# 8052; RRID: AB_11178947 anti-NRF2 Cell Signaling Technology Cat# 12721; RRID: AB_10891429 anti-p62 Cell Signaling Technology Cat# 23214; RRID: AB_2798858 anti-rabbit HRP Conjugate Cell signaling technologies Cat# 7074S; RRID: AB_2099233 anti-YAP/TAZ Cell signaling technologies Cat# 8418; RRID: AB_10950494 Envision+ System-HRP Labeled Polymer Anti-Rabbit Dako Cat# K4003 Rabbit (DA1E) mAb IgG Cell Signaling Technology Cat #3900; RRID: AB_1550038 Bacterial and virus strains Adeno-associated virus expressing human NRF1(NM_003204.2) Pennsylvania Vector Biocore N/A Liver-targeting adeno-associated virus expressing Cre recombinase Pennsylvania Vector Biocore Addgene Cat# 107787-AAV8 Liver-targeting adeno-associated virus expressing GFP Pennsylvania Vector Biocore Addgene Cat# 105535-AAV8 Chemicals, peptides, and recombinant proteins Bardoxolone methyl Selleckchem Cat# S6647 ChIP-Grade Protein G Magnetic Beads Cell signaling technologies Cat# #9006 Diaminobenzidine(DAB) Dako Cat# K3468 DNAzol Invitrogen Cat# 10974020 Infinity Triglyceride Reagent ThermoFisher Scientific Cat# TR22421 Glass Slides VWR Cat # 48311-703 Mounting medium Polysciences Cat # 18606 Nitrocellulose membrane Bio-Rad Cat# 162-0115 NP-40 Alternative CalbiochemTM 492016100ML NuPAGE 4%–12% Bis-Tris Protein Gels ThermoFisher Scientific Cat# NP0336 NuPAGE MOPS Running Buffer ThermoFisher Scientific Cat# NP0001 PowerUpTM SYBRTM Green Master Mix ThermoFisher Scientific Cat# A25742 Scigen Tissue-PlusTM O.C.T. .. Compound Scigen Cat# 23-730-571 TRIzol ThermoFisher Scientific Cat# 15596018 Critical commercial assays Amplex Red Cholesterol Assay Kit Invitrogen Cat# A12216 Alanine Transaminase Colorimetric Activity Assay Kit Caymanchem Cat# 700260 GeneJET PCR Purification Kit ThermoFisher Scientific Cat# K0702 HDL and LDL/VLDL Quantitation Kit Sigma Cat# MAK045-1kt Maxima First Strand cDNA Synthesis Kit ThermoFisher Scientific Cat# K1641 Pierce LTQ Velos ESI Positive Ion Calibration Solution ThermoFisher Scientific Cat# 88322 (Continued on next page) Cell Reports 42, 112399, April 25, 2023 17

    Article Title: Partially dissociable roles of the orbitofrontal cortex and dorsal hippocampus in context-dependent hierarchical associations.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and virus strains AAV8-hSyn-hM4Di-mCherry Addgene #50475-AAV8 AAV8-hSyn-mCherry Addgene #114472-AAV8 Chemicals, peptides, and recombinant proteins Sucrose Fischer Scientific BP220-1 Carprofen Bio-Serv MD150-2 Isoflurane Midwest Veterinary Supply Inc 193.33165.3 Clozapine-N-Oxide dihydrochloride HelloBio #HB6149 Paraformaldehyde Sigma-Aldrich CAS# 30525-89-4 Critical commercial assays Vectashield-DAPI mounting medium Vector Laboratories H-1800 Experimental models: Organisms/strains Long-Evans Charles River N/A Software and algorithms SPSS version 28 IBM SPSS N/A MATLAB R2020a Mathworks N/A Prism version 10 Graphpad N/A MedPC V MedAssociates N/A Other Anesthesia Machine Vetequip V-10 Digital Stereotaxic Instrument Kopf Instruments Model 942 Animal Temperature Regulation System Kent Scientific RightTemp Jr. Hamilton Syringe Hamilton #65460-06 Infusion Pump World Precision Instruments UMP3T-1 Cryostat Leica Biosystems CM1860 Fluorescence Microscope Keyence BZ-X800 ..

    Recombinant:

    Article Title: Cells and circuits for amygdala neuroplasticity in the transition to chronic pain.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rat anti-mCherry Invitrogen Cat# M11217; RRID: AB_2536611 Rabbit anti-b-gal Millipore Sigma Cat# ab986; RRID: AB_92401 Rat anti-somatostatin Millipore Sigma Cat# MAB354; RRID: AB_2255365 Mouse anti-PKCd BD Biosciences Cat# 610398; RRID: AB_397781 Rabbit anti-human/rat CRF Joan Vaughan, Paul Sawchenko Cat# PBL rC68; RRID: AB_2650435 Goat anti-rat Cy3 Invitrogen Cat# A10522; RRID: AB_2534031 Alexa Fluor 647-conjugated goat anti-rabbit Invitrogen Cat# A-21244; RRID: AB_2535812 Alexa Fluor 647-conjugated goat anti-rat Invitrogen Cat# A-21247; RRID: AB_141778 Alexa Fluor Plus 405-conjugated goat anti-mouse Invitrogen Cat# A48255; RRID: AB_2890536 Bacterial and virus strains AAV5-Ef1a-DIO-mCherry University of North Carolina Vector Core Lot# AV4311D, AV4311E, AV4311F, AV4311G AAV5-CaMKII-hChR2(H134R)-EYFP-WPRE-PA University of North Carolina Vector Core Lot# AV4316P, AV4316Q AAVrg-hSyn-DIO-EGFP Bryan Roth Addgene viral prep # 50457-AAVrg AAVrg-FLEX-tdTomato Edward Boyden Addgene viral prep # 28306-AAVrg AAVrg-hSyn-HI-eGFP-Cre-WPRE-SV40 James M. Wilson Addgene viral prep # 105540-AAVrg AAV8-CMV-LacZ-bGH James M. Wilson Addgene viral prep # 105531-AAV8 AAV8-hSyn-DIO-hM4D(Gi)-mCherry Krashes et al.129 Addgene viral prep # 44362-AAV8 AAV8-hSyn-DIO-mCherry Bryan Roth Addgene viral prep # 50459-AAV8 Chemicals, peptides, and recombinant proteins DL-AP5 Tocris Cat# 0105; CAS# 76326-31-3 CNQX disodium salt Tocris Cat# 1045; CAS# 479347-85-8 BIBN4096BS Millipore Sigma Cat# SML2426; CAS# 204697-65-4 Clozapine N-oxide Enzo Life Sciences Cat# BML-NS105; CAS# 34233-69-7 Streptavidin, Alexa Fluor 405 conjugate Invitrogen Cat# S32351 Experimental models: Organisms/strains Rat: Crh-Cre Robert Messing (Pomrenze et al.38) N/A Mouse: C57BL/6J Jackson Laboratory RRID:IMSR_JAX:000664 Mouse: Prkcd-Cre GENSAT RRID:MMRRC_011559-UCD Mouse: Calcrl-Cre Richard Palmiter (Han et al.47) N/A Mouse: Sst-Cre Jackson Laboratory RRID:IMSR_JAX:018973 Mouse: Ai9 Jackson Laboratory RRID:IMSR_JAX:007909 Oligonucleotides Forward primer to genotype for the presence of Cre-recombinase in rats: GCATTACCGG TCGATGCAACGAGTGATGAG Integrated DNA Technologies (IDT) www.idtdna.com Reverse primer to genotype for the presence of Cre-recombinase in rats: GAGTGAACGAA CCTGGTCGAAATCAGTGCG Integrated DNA Technologies (IDT) www.idtdna.com Forward primer to genotype for the presence of Cre-recombinase in mice: TTAATCCATAT TGGCAGAACGAAAACG Transnetyx https://www.transnetyx.com/ (Continued on next page) Cell Reports 43, 114669, September 24, 2024 21 .. REAGENT or RESOURCE SOURCE IDENTIFIER Reverse primer to genotype for the presence of Cre-recombinase in mice: CAGGCTAAGT GCCTTCTCTACA Transnetyx https://www.transnetyx.com/ Software and algorithms ImageJ Schneider et al.130 RRID:SCR_003070; https://imagej.net/ Fiji Schindelin et al.131 RRID:SCR_002285; https://fiji.sc/ pCLAMP 8.2/pCLAMP 11.2/Clampfit 11.2 Molecular Devices, Axon Instruments RRID:SCR_011323; https://www.moleculardevices. com/products/axon-patch-clamp-system/acquisitionand-analysis-software/pclamp-software-suite GraphPad Prism (version 9.5.1 or 10.0.2) GraphPad Software RRID:SCR_002798; https://www.graphpad.com/ Anaconda Distribution version 2023.

    Article Title: Integrating reproductive states and social cues in the control of sociosexual behaviors.
    Article Snippet: Article Integrating reproductive states and social cues in the control of sociosexual behaviors

    Article Title: Adeno-associated viruses for efficient gene expression in the axolotl nervous system
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit anti-RFP Rockland Cat# 600-401-379; RRID: AB_2333092 Rabbit anti-GFP Rockland Cat# 600-401-215; RRID:AB_828167 Mouse anti-GFP Thermo Fisher Scientific Cat# A-11120, RRID:AB_221568 Mouse anti-GFAP-Cy3 Conjugated, Clone G-A-5 Sigma-Aldrich Cat# C9205; RRID: AB_476889 Rabbit anti-Iba1 FUJIFILM Wako Shibayagi Cat# 019-19741, RRID:AB_839504 Goat anti-ChAT Millipore Cat# AB144P, RRID:AB_2079751 Mouse anti-Pax6 Homemade published in62 Donkey anti-mouse Alexa 488 Thermo Fisher Scientific Cat# A-21202; RRID: AB_141607 Donkey anti-mouse Alexa 568 Thermo Fisher Scientific Cat# A-10037; RRID: AB_2534013 Donkey anti-rabbit Alexa 568 Thermo Fisher Scientific Cat# A-10042; RRID: AB_2534017 Donkey anti-mouse Alexa 647 Thermo Fisher Scientific Cat# A-5 31571; RRID: AB_162542 Donkey anti-rabbit Alexa 647 Thermo Fisher Scientific Cat# A-31573; RRID: AB_2536183 Bacterial and virus strains AAV1-CAG:GFP Addgene Cat# 37825-AAV1 AAV2-CAG:GFP Addgene Cat# 37825-AAV2 AAV5-CAG:GFP Addgene Cat# 37825-AAV5 AAV8-CAG:GFP Addgene Cat# 37825-AAV8 AAV9-CAG:GFP Addgene Cat# 37825-AAV9 AAVRG-CAG:GFP Addgene Cat# 37825-AAVrg AAVPHP.eB-CAG:GFP Addgene Cat# 37825-AAVPHP.eB AAV9-CAG:tdTomato Addgene Cat# 59462-AAV9 AAVRG-CAG:tdTomato Addgene Cat# 59462-AAVrg AAV8-hSyn:GFP Addgene Cat# 50465-AAV8 AAV8-CamKIIa:GFP Addgene Cat# 50469-AAV8 Chemicals, peptides, and recombinant proteins .. DAPI Sigma-Aldrich Cat# D9542 DMSO Sigma-Aldrich Cat# D2650 Benzocaine Sigma-Aldrich Cat# E150 H2O2 Sigma-Aldrich Cat# H1009 KOH Sigma-Aldrich Cat# 105033 N,N,N’,N’-tetrakis Sigma-Aldrich Cat# 122262 Triton X-100 Sigma-Aldrich Cat# X100 N-butyldiethanolamine Sigma-Aldrich Cat# 471240 Urea Sigma-Aldrich Cat# U5128 Antipyrine Sigma-Aldrich Cat# A5882 Nicotinamide Sigma-Aldrich Cat# N3376 FastGreen FCF Merck Cat# F7258 OCT compound Science Services Cat# 62550-12 Critical commercial assays HCR Hybridization Buffer Molecular Instruments N/A HCR Amplification Buffer Molecular Instruments N/A HCR Amplifiers Molecular Instruments N/A Experimental models: Organisms/strains Ambystoma mexicanum: d/d IMP N/A Oligonucleotides oligo pool HCR probe for Gad2 IDT published in3 oligo pool HCR probe for Slc17a7 IDT published in3 oligo pool HCR probe for AAV IDT Probe sequence in Table S2.

    Article Title: GABA co-released from striatal dopamine axons dampens phasic dopamine release through autoregulatory GABA A receptors.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Biotinylated donkey anti-rabbit Jackson ImmunoResearch Labs Cat No: 711-065-152; RRID: AB_2340593 Biotinylated goat anti-mouse Vector Laboratories Cat No: BA-9200; RRID: AB_2336171 Chicken anti-Green Fluorescent Protein Aves Labs, Inc Cat No: GFP-1020; RRID: AB_10000240 Donkey anti-mouse IgG conjugated to ultrasmall (0.8 nm) colloidal gold Electron Microscopy Sciences Cat No: 25810 Donkey anti-rabbit IgG conjugated to ultrasmall (0.8 nm) colloidal gold Electron Microscopy Sciences Cat No: 25701 Donkey anti-chicken Cy3 Jackson ImmunoResearch Labs Cat No: 703-165-155; RRID: AB_2340363 Donkey anti-rabbit Cy3 Jackson ImmunoResearch Labs Cat No: 711-165-152; RRID: AB_2307443 Donkey anti-rabbit Cy2 Jackson ImmunoResearch Labs Cat No: 711-225-152; RRID: AB_2340612 Donkey anti-sheep Cy5 Jackson ImmunoResearch Labs Cat No: 713-175-147; RRID: AB_2340730 Mouse anti-Tyrosine hydroxylase monoclonal Boehringer Mannheim Cat No: 1017-381 Rabbit anti-GABAAR a3 (extracellular) polyclonal Alomone Labs Cat No: AGA-003; RRID: AB_2039866 Rabbit anti-GABAAR a3 blocking peptide Alomone Labs Cat No: BLP-GA-003 Rabbit ant-GABAAR d (extracellular) Dr. W. Sieghart N/A Rabbit anti-Tyrosine hydroxylase polyclonal Millipore Cat No: AB152; RRID: AB_390204 Sheep anti-Tyrosine hydroxylase polyclonal Abcam Cat No: ab113; RRID: AB_297905 Bacterial and virus strains AAV8-EF1a-double floxed-hChR2(H134R)mCherry-WPRE-HGHpA pAAV-EF-1a-double floxedhChR2(H134R)-mCherry-WPRE-HGHpA was a gift from Karl Deisseroth Addgene viral prep Cat No: 20297-AAV8 Chemicals, peptides, and recombinant proteins D-AP5 Hello Bio Cat No: HB0225 (+)Bicuculline Sigma-Aldrich Cat No: 14340 Calcium chloride dihydrate (CaCl2.2H2O) Sigma-Aldrich Cat No: C5080 DAB (3,30-Diaminobenzidine tetrahydrochloride) Sigma-Aldrich Cat No: D5905 DHbE hydrobromide Tocris Bioscience Cat No: 2349 DMSO (dimethyl sulfoxide) Sigma-Aldrich Cat No: 276855 DNQX Hello Bio Cat No: HB0261 DOPAC (3,4-Dihydroxyphenylacetic acid) Sigma-Aldrich Cat No: D-9128 Dopamine hydrochloride (3- hydroxytryramine) Sigma-Aldrich Cat No: H-8502 EDTA (Ethylenediaminetetraacetic acid disodium salt dihydrate) Sigma-Aldrich Cat No: E1644 Ethanol, 200 proof Fisher Scientific Cat No: A962P-4 Euthasol Covetrus SKU No: 009444 Gabazine (SR 95531) Hello Bio Cat No: HB0901 D-(+)-Glucose Sigma-Aldrich Cat No: G-5767 HEPES (Acid) Sigma-Aldrich Cat No: H-3375 HEPES (Sodium Salt) Sigma-Aldrich Cat No: H-7006 Isoflurane Covetrus (NYULH-DCM) SKU No: 029405 (Continued on next page) 16 Cell Reports 43, 113834, March 26, 2024 .. REAGENT or RESOURCE SOURCE IDENTIFIER JNJ-16259685 Tocris Bioscience Cat No: 2333 3-mercaptopropionic acid (3-MPA) Sigma-Aldrich Cat No: M5801 Magnesium sulfate heptahydrate (MgSO4.7H2O) Sigma-Aldrich Cat No: M-1880 Methanol Sigma-Aldrich Cat No: 34860 Muscimol Tocris Bioscience Cat No: 0289 Muscimol Hello Bio Cat No: HB0887 Normal Donkey Serum (NDS) Sigma-Aldrich Cat No: S30-M Paraformaldehyde Fisher Cat No: T353 Paraformaldehyde for EM (4% in 0.1M Phosphate Buffer, PH 7.4 Electron Microscopy Sciences Cat No: 15735-20S Phosphate Buffered Saline (PBS) Sigma-Aldrich Cat No: P7059 Picrotoxin Sigma-Aldrich Cat No: P1675 Picrotoxin Hello Bio Cat No: HB0506 Potassium chloride (KCl) Sigma-Aldrich Cat No: P-3911 Potassium phosphate monobasic (KH2PO4) Sigma-Aldrich Cat No: P-0662 Sodium bicarbonate (NaHC03) Sigma-Aldrich Cat No: S-6014 Sodium-1-heptanesulfanate (C7H15O3SNa) Sigma-Aldrich Cat No: H2766 Sodium chloride (NaCl) Sigma-Aldrich Cat No: S-7653 Sodium octyl sulfate Sigma-Aldrich Cat No: O-4003 Sodium phosphate monobasic monohydrate (NaH2PO4.H2O) Sigma-Aldrich Cat No: S9638 Sucrose Sigma-Aldrich Cat No: S-7903 Strychnine hydrochloride Sigma-Aldrich Cat No: S8759 Triton X-100 Sigma-Aldrich Cat No: T8787 Critical commercial assays Silver Enhancer Kit for Microscopy Kirkegaard & Perry Laboratories (KPL), Inc Cat No: 50-22-01 Vectastain Elite ABC-HRP Kit Vector Labs Cat No: PK6100 Experimental models: Organisms/strains Mouse: Ai32 Jackson Laboratory Stock No: 024109 Mouse: C57BL/6J Jackson Laboratory Stock No: 000664 Mouse: DAT-IRES-Cre Jackson Laboratory Stock No: 006660 Mouse: GAT1flox/flox Tritsch Lab, NYULH geneOway JAX stock No: 037219 Software and algorithms DropViz RNA-Seq Data Saunders et al.48 https://DropViz.org Fiji ImageJ NIH https://imagej.nih.gov/ij/ Fusion Benchtop Image Acquisition Software (ver.

    Article Title: Complementary gene regulation by NRF1 and NRF2 protects against hepatic cholesterol overload.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies anti-4HNE Abcam Cat# ab46545; RRID: AB_722490 anti-F4/80 Cell signaling technologies Cat# 70076; RRID: AB_2799771 anti-GAPDH Invitrogen Cat# AM4300; RRID: AB_2536381 anti-LAMIN A/C Cell Signaling Technology Cat# #4777; RRID: AB_10545756 anti-mouse HRP conjugate Cell signaling technologies Cat# 7076S; RRID: AB_330924 anti-NRF1 Cell Signaling Technology Cat# 8052; RRID: AB_11178947 anti-NRF2 Cell Signaling Technology Cat# 12721; RRID: AB_10891429 anti-p62 Cell Signaling Technology Cat# 23214; RRID: AB_2798858 anti-rabbit HRP Conjugate Cell signaling technologies Cat# 7074S; RRID: AB_2099233 anti-YAP/TAZ Cell signaling technologies Cat# 8418; RRID: AB_10950494 Envision+ System-HRP Labeled Polymer Anti-Rabbit Dako Cat# K4003 Rabbit (DA1E) mAb IgG Cell Signaling Technology Cat #3900; RRID: AB_1550038 Bacterial and virus strains Adeno-associated virus expressing human NRF1(NM_003204.2) Pennsylvania Vector Biocore N/A Liver-targeting adeno-associated virus expressing Cre recombinase Pennsylvania Vector Biocore Addgene Cat# 107787-AAV8 Liver-targeting adeno-associated virus expressing GFP Pennsylvania Vector Biocore Addgene Cat# 105535-AAV8 Chemicals, peptides, and recombinant proteins Bardoxolone methyl Selleckchem Cat# S6647 ChIP-Grade Protein G Magnetic Beads Cell signaling technologies Cat# #9006 Diaminobenzidine(DAB) Dako Cat# K3468 DNAzol Invitrogen Cat# 10974020 Infinity Triglyceride Reagent ThermoFisher Scientific Cat# TR22421 Glass Slides VWR Cat # 48311-703 Mounting medium Polysciences Cat # 18606 Nitrocellulose membrane Bio-Rad Cat# 162-0115 NP-40 Alternative CalbiochemTM 492016100ML NuPAGE 4%–12% Bis-Tris Protein Gels ThermoFisher Scientific Cat# NP0336 NuPAGE MOPS Running Buffer ThermoFisher Scientific Cat# NP0001 PowerUpTM SYBRTM Green Master Mix ThermoFisher Scientific Cat# A25742 Scigen Tissue-PlusTM O.C.T. .. Compound Scigen Cat# 23-730-571 TRIzol ThermoFisher Scientific Cat# 15596018 Critical commercial assays Amplex Red Cholesterol Assay Kit Invitrogen Cat# A12216 Alanine Transaminase Colorimetric Activity Assay Kit Caymanchem Cat# 700260 GeneJET PCR Purification Kit ThermoFisher Scientific Cat# K0702 HDL and LDL/VLDL Quantitation Kit Sigma Cat# MAK045-1kt Maxima First Strand cDNA Synthesis Kit ThermoFisher Scientific Cat# K1641 Pierce LTQ Velos ESI Positive Ion Calibration Solution ThermoFisher Scientific Cat# 88322 (Continued on next page) Cell Reports 42, 112399, April 25, 2023 17

    Article Title: Hypothalamic bile acid-TGR5 signaling protects from obesity.
    Article Snippet: In brief Castellanos-Jankiewicz et al. demonstrate that activation of central TGR5 signaling counteracts diet-induced obesity, whereas genetic downregulation of hypothalamic TGR5 promotes it.. These effects involve modulation of food intake and energy expenditure through the sympathetic nervous system, revealing a long-range bile acid-dependent hypothalamic mechanism contributing to weight regulation in obesity.

    Article Title: Partially dissociable roles of the orbitofrontal cortex and dorsal hippocampus in context-dependent hierarchical associations.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and virus strains AAV8-hSyn-hM4Di-mCherry Addgene #50475-AAV8 AAV8-hSyn-mCherry Addgene #114472-AAV8 Chemicals, peptides, and recombinant proteins Sucrose Fischer Scientific BP220-1 Carprofen Bio-Serv MD150-2 Isoflurane Midwest Veterinary Supply Inc 193.33165.3 Clozapine-N-Oxide dihydrochloride HelloBio #HB6149 Paraformaldehyde Sigma-Aldrich CAS# 30525-89-4 Critical commercial assays Vectashield-DAPI mounting medium Vector Laboratories H-1800 Experimental models: Organisms/strains Long-Evans Charles River N/A Software and algorithms SPSS version 28 IBM SPSS N/A MATLAB R2020a Mathworks N/A Prism version 10 Graphpad N/A MedPC V MedAssociates N/A Other Anesthesia Machine Vetequip V-10 Digital Stereotaxic Instrument Kopf Instruments Model 942 Animal Temperature Regulation System Kent Scientific RightTemp Jr. Hamilton Syringe Hamilton #65460-06 Infusion Pump World Precision Instruments UMP3T-1 Cryostat Leica Biosystems CM1860 Fluorescence Microscope Keyence BZ-X800 ..

    Control:

    Article Title: Integrating reproductive states and social cues in the control of sociosexual behaviors.
    Article Snippet: Article Integrating reproductive states and social cues in the control of sociosexual behaviors

    Electron Microscopy:

    Article Title: GABA co-released from striatal dopamine axons dampens phasic dopamine release through autoregulatory GABA A receptors.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Biotinylated donkey anti-rabbit Jackson ImmunoResearch Labs Cat No: 711-065-152; RRID: AB_2340593 Biotinylated goat anti-mouse Vector Laboratories Cat No: BA-9200; RRID: AB_2336171 Chicken anti-Green Fluorescent Protein Aves Labs, Inc Cat No: GFP-1020; RRID: AB_10000240 Donkey anti-mouse IgG conjugated to ultrasmall (0.8 nm) colloidal gold Electron Microscopy Sciences Cat No: 25810 Donkey anti-rabbit IgG conjugated to ultrasmall (0.8 nm) colloidal gold Electron Microscopy Sciences Cat No: 25701 Donkey anti-chicken Cy3 Jackson ImmunoResearch Labs Cat No: 703-165-155; RRID: AB_2340363 Donkey anti-rabbit Cy3 Jackson ImmunoResearch Labs Cat No: 711-165-152; RRID: AB_2307443 Donkey anti-rabbit Cy2 Jackson ImmunoResearch Labs Cat No: 711-225-152; RRID: AB_2340612 Donkey anti-sheep Cy5 Jackson ImmunoResearch Labs Cat No: 713-175-147; RRID: AB_2340730 Mouse anti-Tyrosine hydroxylase monoclonal Boehringer Mannheim Cat No: 1017-381 Rabbit anti-GABAAR a3 (extracellular) polyclonal Alomone Labs Cat No: AGA-003; RRID: AB_2039866 Rabbit anti-GABAAR a3 blocking peptide Alomone Labs Cat No: BLP-GA-003 Rabbit ant-GABAAR d (extracellular) Dr. W. Sieghart N/A Rabbit anti-Tyrosine hydroxylase polyclonal Millipore Cat No: AB152; RRID: AB_390204 Sheep anti-Tyrosine hydroxylase polyclonal Abcam Cat No: ab113; RRID: AB_297905 Bacterial and virus strains AAV8-EF1a-double floxed-hChR2(H134R)mCherry-WPRE-HGHpA pAAV-EF-1a-double floxedhChR2(H134R)-mCherry-WPRE-HGHpA was a gift from Karl Deisseroth Addgene viral prep Cat No: 20297-AAV8 Chemicals, peptides, and recombinant proteins D-AP5 Hello Bio Cat No: HB0225 (+)Bicuculline Sigma-Aldrich Cat No: 14340 Calcium chloride dihydrate (CaCl2.2H2O) Sigma-Aldrich Cat No: C5080 DAB (3,30-Diaminobenzidine tetrahydrochloride) Sigma-Aldrich Cat No: D5905 DHbE hydrobromide Tocris Bioscience Cat No: 2349 DMSO (dimethyl sulfoxide) Sigma-Aldrich Cat No: 276855 DNQX Hello Bio Cat No: HB0261 DOPAC (3,4-Dihydroxyphenylacetic acid) Sigma-Aldrich Cat No: D-9128 Dopamine hydrochloride (3- hydroxytryramine) Sigma-Aldrich Cat No: H-8502 EDTA (Ethylenediaminetetraacetic acid disodium salt dihydrate) Sigma-Aldrich Cat No: E1644 Ethanol, 200 proof Fisher Scientific Cat No: A962P-4 Euthasol Covetrus SKU No: 009444 Gabazine (SR 95531) Hello Bio Cat No: HB0901 D-(+)-Glucose Sigma-Aldrich Cat No: G-5767 HEPES (Acid) Sigma-Aldrich Cat No: H-3375 HEPES (Sodium Salt) Sigma-Aldrich Cat No: H-7006 Isoflurane Covetrus (NYULH-DCM) SKU No: 029405 (Continued on next page) 16 Cell Reports 43, 113834, March 26, 2024 .. REAGENT or RESOURCE SOURCE IDENTIFIER JNJ-16259685 Tocris Bioscience Cat No: 2333 3-mercaptopropionic acid (3-MPA) Sigma-Aldrich Cat No: M5801 Magnesium sulfate heptahydrate (MgSO4.7H2O) Sigma-Aldrich Cat No: M-1880 Methanol Sigma-Aldrich Cat No: 34860 Muscimol Tocris Bioscience Cat No: 0289 Muscimol Hello Bio Cat No: HB0887 Normal Donkey Serum (NDS) Sigma-Aldrich Cat No: S30-M Paraformaldehyde Fisher Cat No: T353 Paraformaldehyde for EM (4% in 0.1M Phosphate Buffer, PH 7.4 Electron Microscopy Sciences Cat No: 15735-20S Phosphate Buffered Saline (PBS) Sigma-Aldrich Cat No: P7059 Picrotoxin Sigma-Aldrich Cat No: P1675 Picrotoxin Hello Bio Cat No: HB0506 Potassium chloride (KCl) Sigma-Aldrich Cat No: P-3911 Potassium phosphate monobasic (KH2PO4) Sigma-Aldrich Cat No: P-0662 Sodium bicarbonate (NaHC03) Sigma-Aldrich Cat No: S-6014 Sodium-1-heptanesulfanate (C7H15O3SNa) Sigma-Aldrich Cat No: H2766 Sodium chloride (NaCl) Sigma-Aldrich Cat No: S-7653 Sodium octyl sulfate Sigma-Aldrich Cat No: O-4003 Sodium phosphate monobasic monohydrate (NaH2PO4.H2O) Sigma-Aldrich Cat No: S9638 Sucrose Sigma-Aldrich Cat No: S-7903 Strychnine hydrochloride Sigma-Aldrich Cat No: S8759 Triton X-100 Sigma-Aldrich Cat No: T8787 Critical commercial assays Silver Enhancer Kit for Microscopy Kirkegaard & Perry Laboratories (KPL), Inc Cat No: 50-22-01 Vectastain Elite ABC-HRP Kit Vector Labs Cat No: PK6100 Experimental models: Organisms/strains Mouse: Ai32 Jackson Laboratory Stock No: 024109 Mouse: C57BL/6J Jackson Laboratory Stock No: 000664 Mouse: DAT-IRES-Cre Jackson Laboratory Stock No: 006660 Mouse: GAT1flox/flox Tritsch Lab, NYULH geneOway JAX stock No: 037219 Software and algorithms DropViz RNA-Seq Data Saunders et al.48 https://DropViz.org Fiji ImageJ NIH https://imagej.nih.gov/ij/ Fusion Benchtop Image Acquisition Software (ver.

    Blocking Assay:

    Article Title: GABA co-released from striatal dopamine axons dampens phasic dopamine release through autoregulatory GABA A receptors.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Biotinylated donkey anti-rabbit Jackson ImmunoResearch Labs Cat No: 711-065-152; RRID: AB_2340593 Biotinylated goat anti-mouse Vector Laboratories Cat No: BA-9200; RRID: AB_2336171 Chicken anti-Green Fluorescent Protein Aves Labs, Inc Cat No: GFP-1020; RRID: AB_10000240 Donkey anti-mouse IgG conjugated to ultrasmall (0.8 nm) colloidal gold Electron Microscopy Sciences Cat No: 25810 Donkey anti-rabbit IgG conjugated to ultrasmall (0.8 nm) colloidal gold Electron Microscopy Sciences Cat No: 25701 Donkey anti-chicken Cy3 Jackson ImmunoResearch Labs Cat No: 703-165-155; RRID: AB_2340363 Donkey anti-rabbit Cy3 Jackson ImmunoResearch Labs Cat No: 711-165-152; RRID: AB_2307443 Donkey anti-rabbit Cy2 Jackson ImmunoResearch Labs Cat No: 711-225-152; RRID: AB_2340612 Donkey anti-sheep Cy5 Jackson ImmunoResearch Labs Cat No: 713-175-147; RRID: AB_2340730 Mouse anti-Tyrosine hydroxylase monoclonal Boehringer Mannheim Cat No: 1017-381 Rabbit anti-GABAAR a3 (extracellular) polyclonal Alomone Labs Cat No: AGA-003; RRID: AB_2039866 Rabbit anti-GABAAR a3 blocking peptide Alomone Labs Cat No: BLP-GA-003 Rabbit ant-GABAAR d (extracellular) Dr. W. Sieghart N/A Rabbit anti-Tyrosine hydroxylase polyclonal Millipore Cat No: AB152; RRID: AB_390204 Sheep anti-Tyrosine hydroxylase polyclonal Abcam Cat No: ab113; RRID: AB_297905 Bacterial and virus strains AAV8-EF1a-double floxed-hChR2(H134R)mCherry-WPRE-HGHpA pAAV-EF-1a-double floxedhChR2(H134R)-mCherry-WPRE-HGHpA was a gift from Karl Deisseroth Addgene viral prep Cat No: 20297-AAV8 Chemicals, peptides, and recombinant proteins D-AP5 Hello Bio Cat No: HB0225 (+)Bicuculline Sigma-Aldrich Cat No: 14340 Calcium chloride dihydrate (CaCl2.2H2O) Sigma-Aldrich Cat No: C5080 DAB (3,30-Diaminobenzidine tetrahydrochloride) Sigma-Aldrich Cat No: D5905 DHbE hydrobromide Tocris Bioscience Cat No: 2349 DMSO (dimethyl sulfoxide) Sigma-Aldrich Cat No: 276855 DNQX Hello Bio Cat No: HB0261 DOPAC (3,4-Dihydroxyphenylacetic acid) Sigma-Aldrich Cat No: D-9128 Dopamine hydrochloride (3- hydroxytryramine) Sigma-Aldrich Cat No: H-8502 EDTA (Ethylenediaminetetraacetic acid disodium salt dihydrate) Sigma-Aldrich Cat No: E1644 Ethanol, 200 proof Fisher Scientific Cat No: A962P-4 Euthasol Covetrus SKU No: 009444 Gabazine (SR 95531) Hello Bio Cat No: HB0901 D-(+)-Glucose Sigma-Aldrich Cat No: G-5767 HEPES (Acid) Sigma-Aldrich Cat No: H-3375 HEPES (Sodium Salt) Sigma-Aldrich Cat No: H-7006 Isoflurane Covetrus (NYULH-DCM) SKU No: 029405 (Continued on next page) 16 Cell Reports 43, 113834, March 26, 2024 .. REAGENT or RESOURCE SOURCE IDENTIFIER JNJ-16259685 Tocris Bioscience Cat No: 2333 3-mercaptopropionic acid (3-MPA) Sigma-Aldrich Cat No: M5801 Magnesium sulfate heptahydrate (MgSO4.7H2O) Sigma-Aldrich Cat No: M-1880 Methanol Sigma-Aldrich Cat No: 34860 Muscimol Tocris Bioscience Cat No: 0289 Muscimol Hello Bio Cat No: HB0887 Normal Donkey Serum (NDS) Sigma-Aldrich Cat No: S30-M Paraformaldehyde Fisher Cat No: T353 Paraformaldehyde for EM (4% in 0.1M Phosphate Buffer, PH 7.4 Electron Microscopy Sciences Cat No: 15735-20S Phosphate Buffered Saline (PBS) Sigma-Aldrich Cat No: P7059 Picrotoxin Sigma-Aldrich Cat No: P1675 Picrotoxin Hello Bio Cat No: HB0506 Potassium chloride (KCl) Sigma-Aldrich Cat No: P-3911 Potassium phosphate monobasic (KH2PO4) Sigma-Aldrich Cat No: P-0662 Sodium bicarbonate (NaHC03) Sigma-Aldrich Cat No: S-6014 Sodium-1-heptanesulfanate (C7H15O3SNa) Sigma-Aldrich Cat No: H2766 Sodium chloride (NaCl) Sigma-Aldrich Cat No: S-7653 Sodium octyl sulfate Sigma-Aldrich Cat No: O-4003 Sodium phosphate monobasic monohydrate (NaH2PO4.H2O) Sigma-Aldrich Cat No: S9638 Sucrose Sigma-Aldrich Cat No: S-7903 Strychnine hydrochloride Sigma-Aldrich Cat No: S8759 Triton X-100 Sigma-Aldrich Cat No: T8787 Critical commercial assays Silver Enhancer Kit for Microscopy Kirkegaard & Perry Laboratories (KPL), Inc Cat No: 50-22-01 Vectastain Elite ABC-HRP Kit Vector Labs Cat No: PK6100 Experimental models: Organisms/strains Mouse: Ai32 Jackson Laboratory Stock No: 024109 Mouse: C57BL/6J Jackson Laboratory Stock No: 000664 Mouse: DAT-IRES-Cre Jackson Laboratory Stock No: 006660 Mouse: GAT1flox/flox Tritsch Lab, NYULH geneOway JAX stock No: 037219 Software and algorithms DropViz RNA-Seq Data Saunders et al.48 https://DropViz.org Fiji ImageJ NIH https://imagej.nih.gov/ij/ Fusion Benchtop Image Acquisition Software (ver.

    Labeling:

    Article Title: Complementary gene regulation by NRF1 and NRF2 protects against hepatic cholesterol overload.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies anti-4HNE Abcam Cat# ab46545; RRID: AB_722490 anti-F4/80 Cell signaling technologies Cat# 70076; RRID: AB_2799771 anti-GAPDH Invitrogen Cat# AM4300; RRID: AB_2536381 anti-LAMIN A/C Cell Signaling Technology Cat# #4777; RRID: AB_10545756 anti-mouse HRP conjugate Cell signaling technologies Cat# 7076S; RRID: AB_330924 anti-NRF1 Cell Signaling Technology Cat# 8052; RRID: AB_11178947 anti-NRF2 Cell Signaling Technology Cat# 12721; RRID: AB_10891429 anti-p62 Cell Signaling Technology Cat# 23214; RRID: AB_2798858 anti-rabbit HRP Conjugate Cell signaling technologies Cat# 7074S; RRID: AB_2099233 anti-YAP/TAZ Cell signaling technologies Cat# 8418; RRID: AB_10950494 Envision+ System-HRP Labeled Polymer Anti-Rabbit Dako Cat# K4003 Rabbit (DA1E) mAb IgG Cell Signaling Technology Cat #3900; RRID: AB_1550038 Bacterial and virus strains Adeno-associated virus expressing human NRF1(NM_003204.2) Pennsylvania Vector Biocore N/A Liver-targeting adeno-associated virus expressing Cre recombinase Pennsylvania Vector Biocore Addgene Cat# 107787-AAV8 Liver-targeting adeno-associated virus expressing GFP Pennsylvania Vector Biocore Addgene Cat# 105535-AAV8 Chemicals, peptides, and recombinant proteins Bardoxolone methyl Selleckchem Cat# S6647 ChIP-Grade Protein G Magnetic Beads Cell signaling technologies Cat# #9006 Diaminobenzidine(DAB) Dako Cat# K3468 DNAzol Invitrogen Cat# 10974020 Infinity Triglyceride Reagent ThermoFisher Scientific Cat# TR22421 Glass Slides VWR Cat # 48311-703 Mounting medium Polysciences Cat # 18606 Nitrocellulose membrane Bio-Rad Cat# 162-0115 NP-40 Alternative CalbiochemTM 492016100ML NuPAGE 4%–12% Bis-Tris Protein Gels ThermoFisher Scientific Cat# NP0336 NuPAGE MOPS Running Buffer ThermoFisher Scientific Cat# NP0001 PowerUpTM SYBRTM Green Master Mix ThermoFisher Scientific Cat# A25742 Scigen Tissue-PlusTM O.C.T. .. Compound Scigen Cat# 23-730-571 TRIzol ThermoFisher Scientific Cat# 15596018 Critical commercial assays Amplex Red Cholesterol Assay Kit Invitrogen Cat# A12216 Alanine Transaminase Colorimetric Activity Assay Kit Caymanchem Cat# 700260 GeneJET PCR Purification Kit ThermoFisher Scientific Cat# K0702 HDL and LDL/VLDL Quantitation Kit Sigma Cat# MAK045-1kt Maxima First Strand cDNA Synthesis Kit ThermoFisher Scientific Cat# K1641 Pierce LTQ Velos ESI Positive Ion Calibration Solution ThermoFisher Scientific Cat# 88322 (Continued on next page) Cell Reports 42, 112399, April 25, 2023 17

    Polymer:

    Article Title: Complementary gene regulation by NRF1 and NRF2 protects against hepatic cholesterol overload.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies anti-4HNE Abcam Cat# ab46545; RRID: AB_722490 anti-F4/80 Cell signaling technologies Cat# 70076; RRID: AB_2799771 anti-GAPDH Invitrogen Cat# AM4300; RRID: AB_2536381 anti-LAMIN A/C Cell Signaling Technology Cat# #4777; RRID: AB_10545756 anti-mouse HRP conjugate Cell signaling technologies Cat# 7076S; RRID: AB_330924 anti-NRF1 Cell Signaling Technology Cat# 8052; RRID: AB_11178947 anti-NRF2 Cell Signaling Technology Cat# 12721; RRID: AB_10891429 anti-p62 Cell Signaling Technology Cat# 23214; RRID: AB_2798858 anti-rabbit HRP Conjugate Cell signaling technologies Cat# 7074S; RRID: AB_2099233 anti-YAP/TAZ Cell signaling technologies Cat# 8418; RRID: AB_10950494 Envision+ System-HRP Labeled Polymer Anti-Rabbit Dako Cat# K4003 Rabbit (DA1E) mAb IgG Cell Signaling Technology Cat #3900; RRID: AB_1550038 Bacterial and virus strains Adeno-associated virus expressing human NRF1(NM_003204.2) Pennsylvania Vector Biocore N/A Liver-targeting adeno-associated virus expressing Cre recombinase Pennsylvania Vector Biocore Addgene Cat# 107787-AAV8 Liver-targeting adeno-associated virus expressing GFP Pennsylvania Vector Biocore Addgene Cat# 105535-AAV8 Chemicals, peptides, and recombinant proteins Bardoxolone methyl Selleckchem Cat# S6647 ChIP-Grade Protein G Magnetic Beads Cell signaling technologies Cat# #9006 Diaminobenzidine(DAB) Dako Cat# K3468 DNAzol Invitrogen Cat# 10974020 Infinity Triglyceride Reagent ThermoFisher Scientific Cat# TR22421 Glass Slides VWR Cat # 48311-703 Mounting medium Polysciences Cat # 18606 Nitrocellulose membrane Bio-Rad Cat# 162-0115 NP-40 Alternative CalbiochemTM 492016100ML NuPAGE 4%–12% Bis-Tris Protein Gels ThermoFisher Scientific Cat# NP0336 NuPAGE MOPS Running Buffer ThermoFisher Scientific Cat# NP0001 PowerUpTM SYBRTM Green Master Mix ThermoFisher Scientific Cat# A25742 Scigen Tissue-PlusTM O.C.T. .. Compound Scigen Cat# 23-730-571 TRIzol ThermoFisher Scientific Cat# 15596018 Critical commercial assays Amplex Red Cholesterol Assay Kit Invitrogen Cat# A12216 Alanine Transaminase Colorimetric Activity Assay Kit Caymanchem Cat# 700260 GeneJET PCR Purification Kit ThermoFisher Scientific Cat# K0702 HDL and LDL/VLDL Quantitation Kit Sigma Cat# MAK045-1kt Maxima First Strand cDNA Synthesis Kit ThermoFisher Scientific Cat# K1641 Pierce LTQ Velos ESI Positive Ion Calibration Solution ThermoFisher Scientific Cat# 88322 (Continued on next page) Cell Reports 42, 112399, April 25, 2023 17

    Expressing:

    Article Title: Complementary gene regulation by NRF1 and NRF2 protects against hepatic cholesterol overload.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies anti-4HNE Abcam Cat# ab46545; RRID: AB_722490 anti-F4/80 Cell signaling technologies Cat# 70076; RRID: AB_2799771 anti-GAPDH Invitrogen Cat# AM4300; RRID: AB_2536381 anti-LAMIN A/C Cell Signaling Technology Cat# #4777; RRID: AB_10545756 anti-mouse HRP conjugate Cell signaling technologies Cat# 7076S; RRID: AB_330924 anti-NRF1 Cell Signaling Technology Cat# 8052; RRID: AB_11178947 anti-NRF2 Cell Signaling Technology Cat# 12721; RRID: AB_10891429 anti-p62 Cell Signaling Technology Cat# 23214; RRID: AB_2798858 anti-rabbit HRP Conjugate Cell signaling technologies Cat# 7074S; RRID: AB_2099233 anti-YAP/TAZ Cell signaling technologies Cat# 8418; RRID: AB_10950494 Envision+ System-HRP Labeled Polymer Anti-Rabbit Dako Cat# K4003 Rabbit (DA1E) mAb IgG Cell Signaling Technology Cat #3900; RRID: AB_1550038 Bacterial and virus strains Adeno-associated virus expressing human NRF1(NM_003204.2) Pennsylvania Vector Biocore N/A Liver-targeting adeno-associated virus expressing Cre recombinase Pennsylvania Vector Biocore Addgene Cat# 107787-AAV8 Liver-targeting adeno-associated virus expressing GFP Pennsylvania Vector Biocore Addgene Cat# 105535-AAV8 Chemicals, peptides, and recombinant proteins Bardoxolone methyl Selleckchem Cat# S6647 ChIP-Grade Protein G Magnetic Beads Cell signaling technologies Cat# #9006 Diaminobenzidine(DAB) Dako Cat# K3468 DNAzol Invitrogen Cat# 10974020 Infinity Triglyceride Reagent ThermoFisher Scientific Cat# TR22421 Glass Slides VWR Cat # 48311-703 Mounting medium Polysciences Cat # 18606 Nitrocellulose membrane Bio-Rad Cat# 162-0115 NP-40 Alternative CalbiochemTM 492016100ML NuPAGE 4%–12% Bis-Tris Protein Gels ThermoFisher Scientific Cat# NP0336 NuPAGE MOPS Running Buffer ThermoFisher Scientific Cat# NP0001 PowerUpTM SYBRTM Green Master Mix ThermoFisher Scientific Cat# A25742 Scigen Tissue-PlusTM O.C.T. .. Compound Scigen Cat# 23-730-571 TRIzol ThermoFisher Scientific Cat# 15596018 Critical commercial assays Amplex Red Cholesterol Assay Kit Invitrogen Cat# A12216 Alanine Transaminase Colorimetric Activity Assay Kit Caymanchem Cat# 700260 GeneJET PCR Purification Kit ThermoFisher Scientific Cat# K0702 HDL and LDL/VLDL Quantitation Kit Sigma Cat# MAK045-1kt Maxima First Strand cDNA Synthesis Kit ThermoFisher Scientific Cat# K1641 Pierce LTQ Velos ESI Positive Ion Calibration Solution ThermoFisher Scientific Cat# 88322 (Continued on next page) Cell Reports 42, 112399, April 25, 2023 17

    Chromatin Immunoprecipitation:

    Article Title: Complementary gene regulation by NRF1 and NRF2 protects against hepatic cholesterol overload.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies anti-4HNE Abcam Cat# ab46545; RRID: AB_722490 anti-F4/80 Cell signaling technologies Cat# 70076; RRID: AB_2799771 anti-GAPDH Invitrogen Cat# AM4300; RRID: AB_2536381 anti-LAMIN A/C Cell Signaling Technology Cat# #4777; RRID: AB_10545756 anti-mouse HRP conjugate Cell signaling technologies Cat# 7076S; RRID: AB_330924 anti-NRF1 Cell Signaling Technology Cat# 8052; RRID: AB_11178947 anti-NRF2 Cell Signaling Technology Cat# 12721; RRID: AB_10891429 anti-p62 Cell Signaling Technology Cat# 23214; RRID: AB_2798858 anti-rabbit HRP Conjugate Cell signaling technologies Cat# 7074S; RRID: AB_2099233 anti-YAP/TAZ Cell signaling technologies Cat# 8418; RRID: AB_10950494 Envision+ System-HRP Labeled Polymer Anti-Rabbit Dako Cat# K4003 Rabbit (DA1E) mAb IgG Cell Signaling Technology Cat #3900; RRID: AB_1550038 Bacterial and virus strains Adeno-associated virus expressing human NRF1(NM_003204.2) Pennsylvania Vector Biocore N/A Liver-targeting adeno-associated virus expressing Cre recombinase Pennsylvania Vector Biocore Addgene Cat# 107787-AAV8 Liver-targeting adeno-associated virus expressing GFP Pennsylvania Vector Biocore Addgene Cat# 105535-AAV8 Chemicals, peptides, and recombinant proteins Bardoxolone methyl Selleckchem Cat# S6647 ChIP-Grade Protein G Magnetic Beads Cell signaling technologies Cat# #9006 Diaminobenzidine(DAB) Dako Cat# K3468 DNAzol Invitrogen Cat# 10974020 Infinity Triglyceride Reagent ThermoFisher Scientific Cat# TR22421 Glass Slides VWR Cat # 48311-703 Mounting medium Polysciences Cat # 18606 Nitrocellulose membrane Bio-Rad Cat# 162-0115 NP-40 Alternative CalbiochemTM 492016100ML NuPAGE 4%–12% Bis-Tris Protein Gels ThermoFisher Scientific Cat# NP0336 NuPAGE MOPS Running Buffer ThermoFisher Scientific Cat# NP0001 PowerUpTM SYBRTM Green Master Mix ThermoFisher Scientific Cat# A25742 Scigen Tissue-PlusTM O.C.T. .. Compound Scigen Cat# 23-730-571 TRIzol ThermoFisher Scientific Cat# 15596018 Critical commercial assays Amplex Red Cholesterol Assay Kit Invitrogen Cat# A12216 Alanine Transaminase Colorimetric Activity Assay Kit Caymanchem Cat# 700260 GeneJET PCR Purification Kit ThermoFisher Scientific Cat# K0702 HDL and LDL/VLDL Quantitation Kit Sigma Cat# MAK045-1kt Maxima First Strand cDNA Synthesis Kit ThermoFisher Scientific Cat# K1641 Pierce LTQ Velos ESI Positive Ion Calibration Solution ThermoFisher Scientific Cat# 88322 (Continued on next page) Cell Reports 42, 112399, April 25, 2023 17

    Magnetic Beads:

    Article Title: Complementary gene regulation by NRF1 and NRF2 protects against hepatic cholesterol overload.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies anti-4HNE Abcam Cat# ab46545; RRID: AB_722490 anti-F4/80 Cell signaling technologies Cat# 70076; RRID: AB_2799771 anti-GAPDH Invitrogen Cat# AM4300; RRID: AB_2536381 anti-LAMIN A/C Cell Signaling Technology Cat# #4777; RRID: AB_10545756 anti-mouse HRP conjugate Cell signaling technologies Cat# 7076S; RRID: AB_330924 anti-NRF1 Cell Signaling Technology Cat# 8052; RRID: AB_11178947 anti-NRF2 Cell Signaling Technology Cat# 12721; RRID: AB_10891429 anti-p62 Cell Signaling Technology Cat# 23214; RRID: AB_2798858 anti-rabbit HRP Conjugate Cell signaling technologies Cat# 7074S; RRID: AB_2099233 anti-YAP/TAZ Cell signaling technologies Cat# 8418; RRID: AB_10950494 Envision+ System-HRP Labeled Polymer Anti-Rabbit Dako Cat# K4003 Rabbit (DA1E) mAb IgG Cell Signaling Technology Cat #3900; RRID: AB_1550038 Bacterial and virus strains Adeno-associated virus expressing human NRF1(NM_003204.2) Pennsylvania Vector Biocore N/A Liver-targeting adeno-associated virus expressing Cre recombinase Pennsylvania Vector Biocore Addgene Cat# 107787-AAV8 Liver-targeting adeno-associated virus expressing GFP Pennsylvania Vector Biocore Addgene Cat# 105535-AAV8 Chemicals, peptides, and recombinant proteins Bardoxolone methyl Selleckchem Cat# S6647 ChIP-Grade Protein G Magnetic Beads Cell signaling technologies Cat# #9006 Diaminobenzidine(DAB) Dako Cat# K3468 DNAzol Invitrogen Cat# 10974020 Infinity Triglyceride Reagent ThermoFisher Scientific Cat# TR22421 Glass Slides VWR Cat # 48311-703 Mounting medium Polysciences Cat # 18606 Nitrocellulose membrane Bio-Rad Cat# 162-0115 NP-40 Alternative CalbiochemTM 492016100ML NuPAGE 4%–12% Bis-Tris Protein Gels ThermoFisher Scientific Cat# NP0336 NuPAGE MOPS Running Buffer ThermoFisher Scientific Cat# NP0001 PowerUpTM SYBRTM Green Master Mix ThermoFisher Scientific Cat# A25742 Scigen Tissue-PlusTM O.C.T. .. Compound Scigen Cat# 23-730-571 TRIzol ThermoFisher Scientific Cat# 15596018 Critical commercial assays Amplex Red Cholesterol Assay Kit Invitrogen Cat# A12216 Alanine Transaminase Colorimetric Activity Assay Kit Caymanchem Cat# 700260 GeneJET PCR Purification Kit ThermoFisher Scientific Cat# K0702 HDL and LDL/VLDL Quantitation Kit Sigma Cat# MAK045-1kt Maxima First Strand cDNA Synthesis Kit ThermoFisher Scientific Cat# K1641 Pierce LTQ Velos ESI Positive Ion Calibration Solution ThermoFisher Scientific Cat# 88322 (Continued on next page) Cell Reports 42, 112399, April 25, 2023 17

    Membrane:

    Article Title: Complementary gene regulation by NRF1 and NRF2 protects against hepatic cholesterol overload.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies anti-4HNE Abcam Cat# ab46545; RRID: AB_722490 anti-F4/80 Cell signaling technologies Cat# 70076; RRID: AB_2799771 anti-GAPDH Invitrogen Cat# AM4300; RRID: AB_2536381 anti-LAMIN A/C Cell Signaling Technology Cat# #4777; RRID: AB_10545756 anti-mouse HRP conjugate Cell signaling technologies Cat# 7076S; RRID: AB_330924 anti-NRF1 Cell Signaling Technology Cat# 8052; RRID: AB_11178947 anti-NRF2 Cell Signaling Technology Cat# 12721; RRID: AB_10891429 anti-p62 Cell Signaling Technology Cat# 23214; RRID: AB_2798858 anti-rabbit HRP Conjugate Cell signaling technologies Cat# 7074S; RRID: AB_2099233 anti-YAP/TAZ Cell signaling technologies Cat# 8418; RRID: AB_10950494 Envision+ System-HRP Labeled Polymer Anti-Rabbit Dako Cat# K4003 Rabbit (DA1E) mAb IgG Cell Signaling Technology Cat #3900; RRID: AB_1550038 Bacterial and virus strains Adeno-associated virus expressing human NRF1(NM_003204.2) Pennsylvania Vector Biocore N/A Liver-targeting adeno-associated virus expressing Cre recombinase Pennsylvania Vector Biocore Addgene Cat# 107787-AAV8 Liver-targeting adeno-associated virus expressing GFP Pennsylvania Vector Biocore Addgene Cat# 105535-AAV8 Chemicals, peptides, and recombinant proteins Bardoxolone methyl Selleckchem Cat# S6647 ChIP-Grade Protein G Magnetic Beads Cell signaling technologies Cat# #9006 Diaminobenzidine(DAB) Dako Cat# K3468 DNAzol Invitrogen Cat# 10974020 Infinity Triglyceride Reagent ThermoFisher Scientific Cat# TR22421 Glass Slides VWR Cat # 48311-703 Mounting medium Polysciences Cat # 18606 Nitrocellulose membrane Bio-Rad Cat# 162-0115 NP-40 Alternative CalbiochemTM 492016100ML NuPAGE 4%–12% Bis-Tris Protein Gels ThermoFisher Scientific Cat# NP0336 NuPAGE MOPS Running Buffer ThermoFisher Scientific Cat# NP0001 PowerUpTM SYBRTM Green Master Mix ThermoFisher Scientific Cat# A25742 Scigen Tissue-PlusTM O.C.T. .. Compound Scigen Cat# 23-730-571 TRIzol ThermoFisher Scientific Cat# 15596018 Critical commercial assays Amplex Red Cholesterol Assay Kit Invitrogen Cat# A12216 Alanine Transaminase Colorimetric Activity Assay Kit Caymanchem Cat# 700260 GeneJET PCR Purification Kit ThermoFisher Scientific Cat# K0702 HDL and LDL/VLDL Quantitation Kit Sigma Cat# MAK045-1kt Maxima First Strand cDNA Synthesis Kit ThermoFisher Scientific Cat# K1641 Pierce LTQ Velos ESI Positive Ion Calibration Solution ThermoFisher Scientific Cat# 88322 (Continued on next page) Cell Reports 42, 112399, April 25, 2023 17

    other:

    Article Title: Phosphorylation of pyruvate dehydrogenase inversely associates with neuronal activity.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Neurobasal-A Medium Gibco Cat# 10888022 B-27 Supplement Gibco Cat# 17504044 GlutaMAX Gibco Cat# 35050061 DNase I, type IV Millipore Sigma Cat# D5025 5-Fluoro-20-deoxyuridine (FUDR) Millipore Sigma Cat# F0503 Poly-D-lysine solution (PDL) Millipore Sigma Cat# A-003-E Carbamide (Urea) Millipore Sigma N/A tris(2-carboxyethyl)phosphine (TCEP) Millipore Sigma N/A Iodoacetamide Millipore Sigma N/A Dithiothreitol (DTT) Millipore Sigma N/A 4-(2-Hydroxyethyl)-1piperazinepropanesulfonic acid (EPPS) Millipore Sigma N/A Acetonitrile Millipore Sigma N/A cOmplete Mini EDTA-free Protease Inhibitor and phosphatase inhibitor PhosSTOP cocktail tablets Roche N/A Lysyl Endopeptidase, Mass Spectrometry Grade (Lys-C) Wako Chemicals N/A Trypsin/Lys-C Mix, Mass Spec Grade Promega N/A SyGreen Blue Mix Genesee Scientific Cat# 17-507 Clozapine N-oxide (CNO) Hello Bio Cat# HB1807 Critical commercial assays Pierce BCA Protein Assay Thermo Scientific Cat# 23227 TMT 11-plex Isobaric Label Reagent Set plus TMT11-131C Label Reagent Thermo Scientific Cat# A34808 and A34807 High-Select Fe-NTA IMAC and TiO2 Phosphopeptide Enrichment Kit Thermo Scientific Cat# A32992 and A32993 High pH C18 Reversed-Phase Peptide Fractionation Kit Thermo Scientific Cat# 84868 Peptide colorimetric assay kit Thermo Scientific Cat# 23275 RNeasy Mini kits Qiagen Cat# 74106 High Capacity cDNA reverse transcription kit Applied Biosystems Cat# 4368813 Experimental models: Organisms/strains Mouse: C57BL/6J Jackson Laboratory Cat# 000664 Mouse: AgRP-IRES-Cre Jackson Laboratory Cat# 012899 Mouse: Vgat-IRES-Cre Jackson Laboratory Cat# 016962 Mouse: Hcrt-IRES-Cre Giardino et al.43 MGI:6201351 Mouse: Ai9 Jackson Laboratory Cat# 007909 Oligonucleotides qPCR Tbp: Forward This paper 5’- CCTTGTACCCTTCACCAATGAC qPCR Tbp: Reverse This paper 5’- ACAGCCAAGATTCACGGTAGA qPCR Arc: Forward Mukherjee et al.44 5’- GCTGAAGCAGCAGACCTGA qPCR Arc: Reverse Mukherjee et al.44 5’- TTCACTGGTATGAATCACTGCTG qPCR Fos: Forward Mukherjee et al.44 5’- GGGAGGACCTTACCTGTTCG qPCR Fos: Reverse Mukherjee et al.44 5’- AGGCCAGATGTGGATGCTT qPCR Npas4: Forward This paper 5’- CAGATCAACGCCGAGATTCG qPCR Npas4: Reverse This paper 5’- CACCCTTGCGAGTGTAGATGC (Continued on next page) Neuron 112, 1–13.e1–e8, March 20, 2024 e2

    Software:

    Article Title: Partially dissociable roles of the orbitofrontal cortex and dorsal hippocampus in context-dependent hierarchical associations.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and virus strains AAV8-hSyn-hM4Di-mCherry Addgene #50475-AAV8 AAV8-hSyn-mCherry Addgene #114472-AAV8 Chemicals, peptides, and recombinant proteins Sucrose Fischer Scientific BP220-1 Carprofen Bio-Serv MD150-2 Isoflurane Midwest Veterinary Supply Inc 193.33165.3 Clozapine-N-Oxide dihydrochloride HelloBio #HB6149 Paraformaldehyde Sigma-Aldrich CAS# 30525-89-4 Critical commercial assays Vectashield-DAPI mounting medium Vector Laboratories H-1800 Experimental models: Organisms/strains Long-Evans Charles River N/A Software and algorithms SPSS version 28 IBM SPSS N/A MATLAB R2020a Mathworks N/A Prism version 10 Graphpad N/A MedPC V MedAssociates N/A Other Anesthesia Machine Vetequip V-10 Digital Stereotaxic Instrument Kopf Instruments Model 942 Animal Temperature Regulation System Kent Scientific RightTemp Jr. Hamilton Syringe Hamilton #65460-06 Infusion Pump World Precision Instruments UMP3T-1 Cryostat Leica Biosystems CM1860 Fluorescence Microscope Keyence BZ-X800 ..

    Temperature Regulation:

    Article Title: Partially dissociable roles of the orbitofrontal cortex and dorsal hippocampus in context-dependent hierarchical associations.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and virus strains AAV8-hSyn-hM4Di-mCherry Addgene #50475-AAV8 AAV8-hSyn-mCherry Addgene #114472-AAV8 Chemicals, peptides, and recombinant proteins Sucrose Fischer Scientific BP220-1 Carprofen Bio-Serv MD150-2 Isoflurane Midwest Veterinary Supply Inc 193.33165.3 Clozapine-N-Oxide dihydrochloride HelloBio #HB6149 Paraformaldehyde Sigma-Aldrich CAS# 30525-89-4 Critical commercial assays Vectashield-DAPI mounting medium Vector Laboratories H-1800 Experimental models: Organisms/strains Long-Evans Charles River N/A Software and algorithms SPSS version 28 IBM SPSS N/A MATLAB R2020a Mathworks N/A Prism version 10 Graphpad N/A MedPC V MedAssociates N/A Other Anesthesia Machine Vetequip V-10 Digital Stereotaxic Instrument Kopf Instruments Model 942 Animal Temperature Regulation System Kent Scientific RightTemp Jr. Hamilton Syringe Hamilton #65460-06 Infusion Pump World Precision Instruments UMP3T-1 Cryostat Leica Biosystems CM1860 Fluorescence Microscope Keyence BZ-X800 ..

    Fluorescence:

    Article Title: Partially dissociable roles of the orbitofrontal cortex and dorsal hippocampus in context-dependent hierarchical associations.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and virus strains AAV8-hSyn-hM4Di-mCherry Addgene #50475-AAV8 AAV8-hSyn-mCherry Addgene #114472-AAV8 Chemicals, peptides, and recombinant proteins Sucrose Fischer Scientific BP220-1 Carprofen Bio-Serv MD150-2 Isoflurane Midwest Veterinary Supply Inc 193.33165.3 Clozapine-N-Oxide dihydrochloride HelloBio #HB6149 Paraformaldehyde Sigma-Aldrich CAS# 30525-89-4 Critical commercial assays Vectashield-DAPI mounting medium Vector Laboratories H-1800 Experimental models: Organisms/strains Long-Evans Charles River N/A Software and algorithms SPSS version 28 IBM SPSS N/A MATLAB R2020a Mathworks N/A Prism version 10 Graphpad N/A MedPC V MedAssociates N/A Other Anesthesia Machine Vetequip V-10 Digital Stereotaxic Instrument Kopf Instruments Model 942 Animal Temperature Regulation System Kent Scientific RightTemp Jr. Hamilton Syringe Hamilton #65460-06 Infusion Pump World Precision Instruments UMP3T-1 Cryostat Leica Biosystems CM1860 Fluorescence Microscope Keyence BZ-X800 ..

    Microscopy:

    Article Title: Partially dissociable roles of the orbitofrontal cortex and dorsal hippocampus in context-dependent hierarchical associations.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and virus strains AAV8-hSyn-hM4Di-mCherry Addgene #50475-AAV8 AAV8-hSyn-mCherry Addgene #114472-AAV8 Chemicals, peptides, and recombinant proteins Sucrose Fischer Scientific BP220-1 Carprofen Bio-Serv MD150-2 Isoflurane Midwest Veterinary Supply Inc 193.33165.3 Clozapine-N-Oxide dihydrochloride HelloBio #HB6149 Paraformaldehyde Sigma-Aldrich CAS# 30525-89-4 Critical commercial assays Vectashield-DAPI mounting medium Vector Laboratories H-1800 Experimental models: Organisms/strains Long-Evans Charles River N/A Software and algorithms SPSS version 28 IBM SPSS N/A MATLAB R2020a Mathworks N/A Prism version 10 Graphpad N/A MedPC V MedAssociates N/A Other Anesthesia Machine Vetequip V-10 Digital Stereotaxic Instrument Kopf Instruments Model 942 Animal Temperature Regulation System Kent Scientific RightTemp Jr. Hamilton Syringe Hamilton #65460-06 Infusion Pump World Precision Instruments UMP3T-1 Cryostat Leica Biosystems CM1860 Fluorescence Microscope Keyence BZ-X800 ..



    Similar Products

    96
    Addgene inc 50459 aav8 chemicals
    50459 Aav8 Chemicals, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/aav8+chemicals/pAAV-hSyn-DIO-mCherry+(Plasmid+%2350459)/pm41330374-599-80-78
    Average 96 stars, based on 1 article reviews
    50459 aav8 chemicals - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    86
    Novo Nordisk 50459 aav8 chemicals
    50459 Aav8 Chemicals, supplied by Novo Nordisk, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/aav8+chemicals/50459+aav8+chemicals/pm41330374-599-80-103
    Average 86 stars, based on 1 article reviews
    50459 aav8 chemicals - by Bioz Stars, 2026-09
    86/100 stars
      Buy from Supplier

    97
    Addgene inc karl deisseroth rrid addgene 114472 aav8 chemicals
    Karl Deisseroth Rrid Addgene 114472 Aav8 Chemicals, supplied by Addgene inc, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/aav8+chemicals/pAAV-hSyn-mCherry+(Plasmid+%23114472)/pm40409256-249-88-91
    Average 97 stars, based on 1 article reviews
    karl deisseroth rrid addgene 114472 aav8 chemicals - by Bioz Stars, 2026-09
    97/100 stars
      Buy from Supplier

    93
    Addgene inc aav8 chemicals
    Aav8 Chemicals, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/aav8+chemicals/pAAV-Ef1a-mCherry+(Plasmid+%23114470)/pm40398420-296-148-147
    Average 93 stars, based on 1 article reviews
    aav8 chemicals - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    96
    Addgene inc aav8 aav8 hsyn cre gfp unc vector core n a aav8 hsyn gfp unc vector core n a chemicals
    Aav8 Aav8 Hsyn Cre Gfp Unc Vector Core N A Aav8 Hsyn Gfp Unc Vector Core N A Chemicals, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/aav8+chemicals/pAAV-EF1a-double+floxed-hChR2(H134R)-mCherry-WPRE-HGHpA+(Plasmid+%2320297)/pm40153436-675-59-57
    Average 96 stars, based on 1 article reviews
    aav8 aav8 hsyn cre gfp unc vector core n a aav8 hsyn gfp unc vector core n a chemicals - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    96
    Addgene inc n a aav8 hsyn dio hm4d gi mcherry addgene rrid addgene 44362 aav8 hsyn dio mcherry addgene rrid addgene 50459 chemicals
    N A Aav8 Hsyn Dio Hm4d Gi Mcherry Addgene Rrid Addgene 44362 Aav8 Hsyn Dio Mcherry Addgene Rrid Addgene 50459 Chemicals, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/aav8+chemicals/pAAV-hSyn-DIO-hM4D(Gi)-mCherry+(Plasmid+%2344362)/pm38056456-260-98-104
    Average 96 stars, based on 1 article reviews
    n a aav8 hsyn dio hm4d gi mcherry addgene rrid addgene 44362 aav8 hsyn dio mcherry addgene rrid addgene 50459 chemicals - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    Image Search Results